../../tmp/servers/virsirnadb/1228792315
Result for your query siRNA sequence
| RED | =100 % Complementary sequence |
| . | =Identical residue |
| blue alphabets | =mismatch |
| _ | =Gap |
| Acc number | Strain name | Start | Alignment | End | % Identity |
| Query | virsi2313 | 1 | tcgcagaaagaaaaatccaac | 21 | |
| AY112987.1 | Semliki forest virus strain L10, complete genome | 3457 | ..................... | 3477 | 100 |
| Z48163.2 | Semliki forest virus genomic RNA for non-structural polyprotein and s | 3456 | ..................... | 3476 | 100 |
| Z48163.2 | Semliki forest virus genomic RNA for non-structural polyprotein and s | 11730 | ______...t.........._ | 11717 | 61 |
| DQ189082.1 | Semliki forest virus isolate ts10 mutant polyprotein nsP1234 and stru | 3371 | ..................... | 3391 | 100 |
| DQ189082.1 | Semliki forest virus isolate ts10 mutant polyprotein nsP1234 and stru | 11332 | ______...t.........._ | 11319 | 61 |
| DQ189084.1 | Semliki forest virus isolate ts13 mutant polyprotein nsP1234 and stru | 3371 | ..................... | 3391 | 100 |
| DQ189084.1 | Semliki forest virus isolate ts13 mutant polyprotein nsP1234 and stru | 11332 | ______...t.........._ | 11319 | 61 |
| DQ189086.1 | Semliki forest virus polyprotein nsP1234 and structural polyprotein g | 3371 | ..................... | 3391 | 100 |
| DQ189086.1 | Semliki forest virus polyprotein nsP1234 and structural polyprotein g | 11332 | ______...t.........._ | 11319 | 61 |
| EU350586.1 | Semliki forest virus from Viet Nam, complete genome | 3578 | ..................... | 3598 | 100 |
| EU350586.1 | Semliki forest virus from Viet Nam, complete genome | 11792 | ______...t.........._ | 11779 | 61 |
| NC_003215.1 | Semliki forest virus, complete genome | 3456 | ..................... | 3476 | 100 |
| NC_003215.1 | Semliki forest virus, complete genome | 11414 | ______...t.........._ | 11401 | 61 |